|
AT5G08185.1
Encodes a microRNA that targets DCL1. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGAUAAACCUCUGCAUCCAG
|
| Lab Annot. |
Mapman: 32 micro RNA, natural antisense etc; 35.2 not assigned.unknown |
| Curated Location |
|
| Species |
Arabidopsis thaliana
Source:
TAIR Arabidopsis (v.10) |
| Links |
TAIR POGS SUBA Uniprot PTM
Get sequence
|
Related Genes
|
| Acc | ver | Species | Evalue | Matchlen | %Iden | %Similar | #spots | TargetP |
| AT5G08185.4 | 10 | Arabidopsis thaliana | 2E-14 | 27 | 100 | 100 | 0 (0) | S |
| AT5G08185.2 | 10 | Arabidopsis thaliana | 2E-14 | 27 | 100 | 100 | 0 (0) | S |
#Spots: The number of publicly accessible spots are in parenthesis
|
| Prediction |
| PFAM: |
|
| TargetP: |
Secreted (Class 2 C0.035; M0.070; S0.855; _0.219) |
| Predotar: |
|
| Subcel. Location: |
|
| TM-HMM prediction: |
No |
| Aramemnon: |
|
| TAT position: |
|
| Length |
45 aa (-cTP 19) |
| Molecular Weight |
5.41 kDA(-cTP ) |
| PI |
7.83(-cTP ) |
|
|
Experimental Evidence
View GeneModel
|
* For details about the exprimental sources
click here.
|
|
Published Proteomics Data
|
|
|
Comparative Proteomics Data
|
|
